GCAGTAATGACGCTGGGCGAAATACGTCCGAAGCAACTGTTGGTG
If you string the above sequence of DNA bases in a crab, you get a piece of crabbiness.AGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACAC
If you string the above sequence, you get a piece of humanness. Nothing startling to a high school sophomore.
If, however, you put the piece of crabbiness into the humanness, though, the human cells will make it exactly the same way the crab cells will. And vice versa. That startles sophomores.
***
Copies of human genes put into the same bacteria that live in your gut, E. coli, will instruct the bacteria to make human genes.
Humulin®, sold as human insulin, isn't so human after all--it's made from poop bugs sitting in large vats, I imagine, then separated from its producers. Novolin®, another version of human insulin, is made using yeast cells.
I did my own bit of yeast farming yesterday--I scraped out about 10 pounds of honey (it had crystallized), crushed about 8 pounds of frozen peaches left over from the summer, mixed them with water and yeast, and now I've got a 6 gallon yeast party going on in the kitchen.
Peaches and honey feed the yeast, and this summer, as the sun sets at a more reasonable hour, Leslie and I will be sitting outside by the basil, sharing peach melomel, the once exuberant yeast dormant on the bottom of the bottle.
The melomel won't cure anything, but it heals a lot. I'm using a process humans have used for thousands of years. Blue crabs make insulin-like proteins, and have, for thousands of years. Life in its myriad organisms bopped along using the same genetic code for over 3 billion years before one strain, H. sapiens, figured this out.
I'm betting most of the folks who designed Humulin® for a living do not grow wheat, or brew beer, or spin cloth from fibers combed from sheep. They're bright, reasonably well paid, and no doubt outstanding citizens in their spheres.
I'm also betting most do not know how to grow wheat, or brew beer, or spin cloth from fibers combed from sheep.
We've mastered the mechanics of designing life the same few generations we lost our taboos, our gods, our guides to living in this happy mess of life we cannot comprehend.
Hubris has a history.
We're going to learn the same lessons again.
Photo by Leslie, taken yesterday, along the Delaware Bay.


10 comments:
Good morning -
So this is the poem that arrived in my inbox from The Writer's Almanac yesterday. Joy by Julie Cadwallader Staub.
This week I will teach 12 middle school students how to operate a sewing machine. We are making tied quilts for Project Linus. We've measured, straightened grain, layered, pinned, and begun tying. Some will be ready to sew on their blanket binding.
One girl suggested that we should have her parents sign a waiver because I will have them operate dangerous machinery. Yep, it's dangerous all right.
Babel, Sirens, Gilgamesh and a Great Flood, the Trojan Horse.
We buried these stories under the cold, hard industrial-strength concrete of the modern age, assuming that we were wiser than our ancestors because we could split an atom and decimate a city.
The ancients knew better than to confuse power with wisdom.
I'm an optimist, though. I don't think I could teach if I wasn't.
When I spend time with my students I become convinced that this next generation (so often called selfish and arrogant) knows better and is begin to tear the concrete up.
Dear Kate,
The poem is wonderful, your project even more so!
Ironic that using a sewing machine is the new Luddism.
The waiver is interesting--though I agree, producing a self-sufficient citizen is more dangerous than the machine.
Dear John,
Agree and agree, but I waffle on the optimism, and I have a question, not a rhetorical one: would you teach even if (or especially if) you believed the dominant culture has us headed to Armageddon?
You have put into words what is easily one of my most common frustrations with our culture/society.
I like to think of it as 'Over-specialization'. The idea that only 'professionals' can do things like:
cook
change a flat tire
make beer
grow food
take care of children
teach
work with plumbing, electricity, HVAC
Sure there is room for professionals due to the magnitude and complexity of some work. But there are certainly general skills and tasks that shouldn't be considered work at all and that any/all of us can do.
Example:
It's a warm 20 degrees here in Wisconsin and I just finished pruning my apple, pear and cherry trees in the back yard. It was fun.
I would teach, but I'd be less like Fozzie Bear and more like Jeremiah. As it stands, I'm currently a little of both.
Dear anonymous,
It's responses like yours that keep me writing. Thanks for the words.
Dear John,
I could use a little more Fozzie Bear in my act.
John, you know those stories aren't buried on my watch, right? :)
Kate - I loved that poem, too!
And sign a waiver? Not surprised. Worked at a retail job a few years back and the young lady did not know how to mop a floor. Or so she said. I think this generation has Tom Sawyer'd us all into thinking they're lacking basic skills.
Doyle, excellent post. I'm not sure I'm ready to tell my diabetic husband where his meds come from.
But he probably knows.
Dear Kelly,
Well, it beats squeezing the pancreases of other species, I imagine.
(I fretted a little bit about the post specifically regarding human insulin, since obviously this is a huge breakthrough for many, many people.)
Thanks for your kind words.
You? Waffle on optimism? You who consistently points to the light that is coming?
Dear Tracy,
Mid-January is as good a time for waffles as any.
I am congenitally happy, if not optimistic. I am very optimistic about life itself, and that whatever it is we cannot understand matters, and that humans belong here as much as the worms.
I am not optimistic, though, about the course of western civilization, no. Since life matters more than power or money or social structure (or any other gifts provided by our version of civilization), I remain a babbling optimist.
It's why I'd rather clam than shop.
Post a Comment