Magic pipette

I get bored during tests, and I tend to get restless. ("Dr. D, you're making too much noise.")

Kids like routines, and here's mine:

1) Pass out the test bunnies, giant cockroach, praying mantis puppet, and a half dozen felt mice. (Talismans in science class, who would've thunk?)

2) Pass out tests.

3) Pass out pencils. ("It will cost you 5 points." Dr. Deeeeeeeee, no fair..... "Have I ever taken a point away?")

4) Get out the magic pipette.

The magic pipette started out as the magic wand ("magic's" a bit redundant, I suppose), then transmogrified into a magic pipette when I misplaced my wand.

During a test, each child gets to use the magic pipette for one question--it will mysteriously land on the right answer.

It started out as a gimmick by a very bored teacher, but I've kept it because it gives me good information. God forbid, it also gives a few kids an extra few points.

What have I learned?

The most confused kids won't even use it--a hard lesson for me to learn. Children feeling defeated will not take help.

If everyone's using it for the same couple of questions, something's likely wrong with the question.

Kids hate it when they already picked the right answer, even if it was chosen completely at random.

My magic pipette won't ever rival Madeline Hunter, but for a few kids, giving away an answer serves as an act of kindness in a world that increasingly frowns on such.

My felt mice and test bunnies are handmade by Jessica Pierce.
If you are easily offended, avoid "Bunnies What Swear" category.

"Arne, you're doing a heckuva job...."

Poor little rich kid.

Mr. Duncan is going to take a lot of flak for his Katrina komment, joining the Brownie School of Fixing by Diaspora, but he's already getting blog-flogged for that.

No, I'm more interested in the psychology of Duncan Dogooder, trying to anticipate how much damage this poor little rich kid is going to inflict on public education before he rides into the sunset, reading The Little Engine That Could to budding embryos in a Chicago church basement.

There are going to be a lot more losers than winners.
I know my popularity's going to plummet.

Arne, on the RttT grant awards

What an odd thing to say.

While I agree, Arne, that your playground popularity right now rests on the dollars you're tossing on the asphalt, I find it telling that your popularity plays into this at all.

Madeline Levine, a clinical psychologist, notes that children who were "indulged, coddled, pressured and micromanaged on the outside...appeared to be inadvertently deprived of the opportunity to develop an inside."

Let's see. Child of professor. Pro ("The Cobra") athlete. Home for a year mid-college to work in his mother's tutoring center.

More from Dr. Levine:

I think there's been a real ratcheting up of materialism, as opposed to an emphasis on making connections with people. Competition counts more than cooperation.

We don't need hurricanes and poor little rich kids to fix our schools. We need communities.

Community is an old word, and a good one. Communis. Shared by many.

New Jersey's RttT application is flawed enough to catch the Washington Post's attention. While we could certainly use the money, I am proud we did not completely capitulate to the whims of a manchild whose life has been framed by a fishbowl.

Until Arne can tell me how many squirrels live on the Bloomfield Green, that poor little rich kid can kiss my arse. He's taken class warfare to W's level.

Heckuva job, Arne.

Kudos to Mike Klonsky's SmallTalk Blog for pointing out the original quote.

PBDE's and the Mary Beth Doyle Act

We are awash in strings of vague capital letters--and it's easy, so easy, to gloss over them like names in a Russian novel.

BPAs, PCBs, PBDEs--yawn....

The PBDEs get the stage this week--flame retardants found in just about everything. Now while I am (mostly) rational, and while I frown on babies in flaming pajamas, seems that the PBDEs designed to protect the little people may prevent the little people from ever arriving.

Looks like PBDEs are fecundability busters.

My sister knew PBDEs were a problem years ago, worked hard to get them banned in Michigan, and she (with many others) did just that.

"The Mary Beth Doyle PBDE Act" got two forms of PBDE banned in Michigan back in 2004, not long after she was run off the road by a devout Christian missionary, who later assured me her death was all part of God's plan; this week the Michigan assembly added a third form of PBDE to the act.

Mary Beth was not a professional scientist, but she was a keen observer. She danced through life. If I could teach anything in science class, it would be how to open your senses to the world. She did just that.



So here's a Mary Beth story, lifted word for word from a friend of hers, Darrin Gunkel. She changed a small corner of the world by her sheer will and her fearlessness, and this story serves her memory well.

Twenty years ago today, Mary Beth and I arrived in the fabled Hunza Valley, the model for Shangri-La, in northern Pakistan. We stayed in a town on a cliff 4,000 feet above the valley floor, in a hotel that cost about 5 bucks with a view of 4-mile-tall Himalayan peaks. The poplars lining irrigation canals – brimming with pearly and opalescent glacier runoff, feeding stone terraces of apricot wheat, mulberry, grapes – had just come to full flame. An orange and yellow hearth fire lapping at the feet of the mountains 18,000 feet high, capped in blue glaciers.The altitude started getting to me. So, Mary Beth took a walk.

A few hours later, she came back, her fancy scarf from the Sindh – the one with real silver threads, presented to her by relatives of the mayor of the town of Khaipur – traded in for one of the rough cotton veils Hunza women wear working their terraced fields.

“I traded my scarf! And got some presents!!” She was carrying a huge bunch of grapes and a loaf of bread that smelled like a fire place and was so dense, huge, and nutritious it took us a week to finish off.

“I met some farmers! Check it out!” She’d spent the afternoon in the compound of a Hunza family, a rare privilege. “They all thought I was insane once I got them to understand I wasn’t lost. Kept asking ‘where’s your husband? (in this medieval world, it was just easier, and more sensible, to claim we were married) Why did he let you come here alone?’ How the fuck am I supposed to explain I’m the one who dragged my ‘husband’ to Pakistan.” (Coming here was Mary Beth’s idea. That’s another story.)

She was glowing from the encounter. Not a lot of people are served tea in the kitchens of Hunzakot matriarchs. Not a lot of people are like Mary Beth. Travel is like being a rock star in that to succeed, it takes a certain talent – the kind Mary Beth possessed in spades, wheel barrows, truck loads full.

Later, we shared this experience: that evening, Hunza was celebrating an Ismaili Muslim festival. After sundown, people scaled the surrounding mountains and set bonfires. As the peaks faded into the night, the whole valley – dozens of miles long, and thousands of feet deep – came alive with bonfires. The sight left even MB speechless. Unforgettable stuff like this made Pakistan her favorite location of the whole year we spent in Asia.

Mary Beth, who I miss more than life itself, was thrilled I decided to become a teacher.

She was no Pollyanna, and knew as well as anyone where we're headed in our current madness, but she danced easily knowing she was part of this wonderful whatever were living through, and she did what she could to make it better.

A terrible landslide devastated the Hunza Valley earlier this month; you probably did not hear of this, no reason to.

We have been bombing tribal villages using drones, aircraft without faces.

If one student of mine wanders happily around this planet because of something that happens in Room B362, I'd say I've done good. I'm not Mary Beth, but I was her big brother.

Who knows who I may be shepherding in class....

"Who's That Girl" was written by Dick Seigel for Mary Beth.
And I'll be poking Darrin for permission when I get roundtuit,

Bipalychaetorsonectomy

"It has always seemed strange to me," said Doc. "The things we admire in men, kindness and generosity, openness, honesty, understanding and feeling are the concomitants of failure in our culture. And those traits we detest, sharpness, greed, acquisitiveness, meanness, egotism and self-interest are the traits of success. And while men admire the quality of the first they love the produce of the second."

John Steinbeck, Cannery Row

My kids can use electronic media--I get that.
They have access to tons of information--I get that, too.
The Finns are kicking our educational buttocks--no need to keep screaming, I hear you.

I teach biology, but more importantly, I teach kids how to see. How to listen. Touch. Sniff. (I draw the line at licking, for safety reasons.)

Arne's Race to the Top presumes a narrow (and ultimately destructive) world view. A decent course in biology, if it focuses on the art of observing life, presumes a wide open (and ultimately unknowable) universe.

It's tough impossible to reconcile the two.

The hero of Cannery row is a scientist. Steinbeck saw the world as a scientist. I would love to introduce Steinbeck to my lambs.

Because of constraints on time, time spent honing for the state test looming in May, I cannot.

Take a look at what we are doing to our children in public schools, and tell me which qualities we are promoting. I'm not looking to create "products." At 15, kids are still human.

I'd like them to stay that way.

Leslie took the photo in Galway, Ireland.

It was a good run....

One of the definitions of sanity is the ability to tell real from unreal. Soon we'll need a new definition.

Alvin Toffler

In two seemingly unrelated news items, we learn that kids spend about 7 1/2 hours plugged into media every day, and that corporations, blessed with the same rights of more corporeal citizens, will be allowed to run ads directly influencing federal races.

Alexis Tocqueville, the data is in, and the experiment has ended.

Draw your own conclusions.

"Descent with modification" vs." Classroom Lord of the E. Coli"

I get a little bit of flak when discussing evolution. Not a lot, but it's real, and I address it. It works well, and essentially explains everything in biology except the source of life itself

Meanwhile, my AP class today stuck the GFP (green fluorescent protein) gene from jellyfish into E. coli, a major poop bug in our gut. No complaints, no oohs and ahhhs. No recognition of the power of what we did.

We transferred genes from one species of one domain (Eukarya) into a species of a completely different domain (Bacteria) in a high school classroom.

We are the new gods--and we are not ready.

Break out the Kool-Aid!

Big news around here is that our school met the state's requirements for NCLB this year. Unless brain surgery becomes more advanced, though, we're doomed by 2014, as are all public schools.

We got the expected slew of emails: "commitment" led to "lofty dividends," we have "pride" and "satisfaction," and for the administration, this must be one heap of steaming relief after a long streak of just missing the cut-off.

It's a heap of steaming relief for me, too--it means that for at least one more year, I can teach unscripted lessons based on real observations, real science, real thinking.

We've gotten so ingrained to AYP we've forgotten just what it is that we accomplished--most of our kids passed a test designed by God knows who to measure God knows what.

Our property values are preserved. Our administration will avoid "Ring Around the Rosie." The townsfolk believe they're getting their money's worth. The budget gets passed.

Any thrill beyond "Whew, that gets the state off our backs," however, is misplaced. No sense giving the AYP nonsense any more gravitas than what it deserves. The emperor has no clothes. There, I said it.

It is nice, though, not to have to explain to my neighbor why we don't suck.

The image is from a woodcut, so I figure it's well past copyright issues.
Who does woodcutting anymore? Who grinds flour?
Who reads these acknowledgments?

Grasping life

GCAGTAATGACGCTGGGCGAAATACGTCCGAAGCAACTGTTGGTG

If you string the above sequence of DNA bases in a crab, you get a piece of crabbiness.

AGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACAC

If you string the above sequence, you get a piece of humanness. Nothing startling to a high school sophomore.

If, however, you put the piece of crabbiness into the humanness, though, the human cells will make it exactly the same way the crab cells will. And vice versa. That startles sophomores.

***

Copies of human genes put into the same bacteria that live in your gut, E. coli, will instruct the bacteria to make human genes.

Humulin®, sold as human insulin, isn't so human after all--it's made from poop bugs sitting in large vats, I imagine, then separated from its producers. Novolin®, another version of human insulin, is made using yeast cells.

I did my own bit of yeast farming yesterday--I scraped out about 10 pounds of honey (it had crystallized), crushed about 8 pounds of frozen peaches left over from the summer, mixed them with water and yeast, and now I've got a 6 gallon yeast party going on in the kitchen.

Peaches and honey feed the yeast, and this summer, as the sun sets at a more reasonable hour, Leslie and I will be sitting outside by the basil, sharing peach melomel, the once exuberant yeast dormant on the bottom of the bottle.

The melomel won't cure anything, but it heals a lot. I'm using a process humans have used for thousands of years. Blue crabs make insulin-like proteins, and have, for thousands of years. Life in its myriad organisms bopped along using the same genetic code for over 3 billion years before one strain, H. sapiens, figured this out.

I'm betting most of the folks who designed Humulin® for a living do not grow wheat, or brew beer, or spin cloth from fibers combed from sheep. They're bright, reasonably well paid, and no doubt outstanding citizens in their spheres.

I'm also betting most do not know how to grow wheat, or brew beer, or spin cloth from fibers combed from sheep.

We've mastered the mechanics of designing life the same few generations we lost our taboos, our gods, our guides to living in this happy mess of life we cannot comprehend.

Hubris has a history.
We're going to learn the same lessons again.

Photo by Leslie, taken yesterday, along the Delaware Bay.

Sylvester McMonkey McBean and the FDA

Mr. McGuire: I just want to say one word to you - just one word.
Ben: Yes sir.
Mr. McGuire: Are you listening?
Ben: Yes I am.
Mr. McGuire: 'Plastics.'

A few years ago, when I was still playing doctor, the FDA released a "Public Health Notification" regarding plasticizers in IV tubing. Back in 2002, when King W sat on the throne, the gummint advised that hospitals avoid DEHP (if possible), particularly for very young males.

I stormed over to the Chair of Pediatrics (not an unusual event) and showed him the memo. He got excited, and talked to the NICU folks, who were already aware, and had made the changes that were financially feasible.

Watch an old war movie. Look at the IV fluids.

Me: I just want to say one word to you - just one word.
Pediatric Chair: Yes, Mike? [exasperated look].
Me: Are you listening?
Pediatric Chair: Yes I am.
Me: 'Glass bottles.'

Oh, yes, glass safety was raised--I keep forgetting about those pesky babies escaping from their isolettes, tossing glass bottle around when the nurse isn't looking.

***

BPA is in the news--the FDA has raised concerns about bisphenol-A (BPA), used in plastics. Yep, the same BPA declared safe in 2008.

Unlike most potential toxins, BPA (and DEHP) mimic hormones--BPA was specifically designed as a synthetic estrogen and noted as such back in 1936 (Dodds and Lawson, Nature 137: 996).

Hormones work in minute quantities. Very minute.

I will be squeezing last summer's peaches into a food grade plastic bucket today, along with a few pounds of honey, some chlorinated water, and yeast. The peaches will thaw in the same bowl my mom used decades ago, and I will think of her.

Next week I will transfer the bubbling mess into a glass carboy.

And this is where I am supposed to preach moderation and sanity--we all use plastic and chlorinated water--it's safe, why feed the scaremongers and tinfoil hat crowd?

Why indeed....

Because we are deliberately putting a compound designed to act like estrogen into our food!

And Sylvester McMonkey McBean?


National Breast Cancer Awareness Month is sponsored (and controlled) by AstraZeneca, a pharmaceutical company descended from Imperial Chemicals Industries (ICI), the inventors of polyethylene, the same stuff treated with BPA to make it more useful for packaging.

ICI makes tamoxifen, a key drug used for treating breast cancer. ICI also makes huge amounts of organochlorines, associated with breast cancer.

Breast cancer rates for women here have risen from less than 1 in 20 rate before 1940 to a 1 in 8 chance today. Next October, during National Breast Cancer Awareness Month, check out how much of the official NBCAM literature mentions environmental causes of breast cancer.

So, yeah, everybody's doing it, drinking BPA, and look, we're all healthy, really.

It's a testament to the power of propaganda that the plastics industry uses a known hormone mimic to package food, and the onus falls on those who think this might be a bad idea to show the link between BPA and ill effects.




(During my mom's last week of consciousness, I carried her to the bathroom, her bones settling into my arms as easily as her nightgown. She died before her 60th birthday. So, yeah, maybe I'm emotionally invested in this--doesn't change the facts, though.)

Images (other than my own) lifted from other websites--
I figure both are icons of culture and fall under Fair Use
in a blog that makes no money and has a readership the size of the Walton family.
If anyone knows otherwise, drop me a line....)

"There is No Natural Religion"

"Then the Lord God formed the man (of) dust of the ground, and breathed into his nostrils the breath of life; and the man became a living soul."

Dust. Dirt. Matter.

Wise words from an ancient peoples, tribes that wrestled with gods almost as imperfect as humans. Our souls were not ephemeral--they were made of matter, dust from the ground, the earth itself.

I obviously cannot (and would not even if I could) rail on about the supernatural in my classroom--but there's plenty to rail about the natural. Science is about the natural world, what we can perceive, and what we can imagine based on what we observe.

You cannot learn about science--it's a mindset, a way of discerning the world, an attempt to make sense of whatever this whatever is. Our minds have a bad habit of wandering around thought to thought, evading the world that might diminish its powers.

The real dirt, the stuff under your feet, the clay that made us--how much do your children know about it?

While Arne and his cronies push the race to the top, fusing the local into a mythical national standard, I push my lambs back home, back to the earth beneath their feet.

Go get dirty.

***

"He who sees the Infinite in all things sees God. He who sees the Ratio only sees himself only."

William Blake

I wanted to get some dirt a couple of days ago to restart my amaryllis. Most of the ground is frozen now, so I dragged in a large planter. I can use the thawed earth for the bulbs.

A few critters will wake up a bit confused, not used to January basements.

Most of the organisms will remain unnoticed by me. A few weeds will start stretching themselves skyward to an imagined sun.

A simple ceramic pot holds a universe too complex for me to grasp. I don't need to grasp it, though--I just plan to borrow it for awhile. When the amaryllis is done flowering, the living earth will be returned to the ground under a July sky.

We get lost in the abstract, in races to the top, in living full lives, in reaching our full potential, in making the big bucks. The more abstract the goal, the more likely you'll walk on concrete to get there. You'll need shoes, good ones. You may need an elevator to get to your office.

The more successful you are, the more layers between you and the dust beneath the city asphalt.

Race to the top? What's the hurry?

***

I want my children to slow down, to smell loamy earth rich with life, to walk barefoot far from the sidewalk. And should they bleed, as they will, their corpuscles will feed the life beneath their feet.

We'll stroll to the bottom, to the muck, and wallow with the ocean of critters who know nothing more than there is to know.

Rattlesnake beans

We started our plants in class back in October.

Some never germinated. Many were never watered after the first couple of days. A couple drowned. Some were misplaced, a half dozen knocked over.

Every day the kids breathed, and every day the surviving plants grew, taking their breath, and making stuff. Water molecules were split, carbon dioxide molecules fixed.

And now, from a few handfuls of seed, we have a riot of colors under our fluorescent lights--Pruden's purple tomatoes, rattlesnake beans, screaming yellow squash flowers, pink pea flowers. 30 or 40 basil plants share the aquarium light with the fish.

Today, I showed the class a mature bean pod, itself holding a few beans ready to carry on to the next generation.

Ally, the plant's owner, opted not to eat the bean, and she would not let me eat it, either. She has grown attached to her plant.

I suppose this can be tossed off as one of those puff pieces, pseudo-education packaged in feel-good stories that plague our nation, damning our nation to economic misery, and I could be (yet) another science teacher who fell off the STEM wagon, spoiled by NEA propaganda and neo-liberal wonkiness.

Science starts with observing nature, whatever this universe thing is. If a child has never witnessed a plant grow, not a whole lot of sense talking about photosynthesis or NADPH or the Calvin cycle.

Long after nucleotides and polymerases fade from their memories, my students will remember their plants.

The photo was taken from Reimer Seeds.

News from latitude 40.8

Nine hours and 29 minutes. Most light since November 30th.
The darkest 6 weeks of the year end tonight.


You could look it up....

January sunset

Just took this picture a few hours ago. It's a bit chilly at the edge of the Delaware Bay, and the breeze was kicking up to 25 knots, but Leslie and I wandered outside anyway, as we pretty much do whenever we can.

Our imaginations are too small for this world.





And you're going to enjoy it, even if we have to legislate it.
Where's Walt Kelly when we need him? Congress puts The Onion to shame.

William Carlos Williams teaches science

I keep thinking about the blue sparks I saw, and heard. Evanescent, almost palpable, rippling under the cotton.

I remember now when I last saw the same kind of ethereal blue. August, at the edge of the bay, I watched an errant comb jelly flash away its last few moments of life.

And my mind keeps wandering back to voltages and electrons, human (though useful) conceits.

No ideas but in things.

William Carlos Williams knew this, I'm still learning it.

We just finished ecology--we started just before the solstice.
I wish I had started with this:

The half-stripped trees
struck by a wind together,
bending all,
the leaves flutter drily
and refuse to let go
or driven like hail
stream bitterly out to one side
and fall
where the salvias, hard carmine—
like no leaf that ever was—
edge the bare garden.

WCW, "Approach of Winter"

No ideas but in things. That's where science starts. In the rolling blue light under a t-shirt is the thing. Everything else about it--voltages and electrons and energy and photons--concepts to explain, epiphenomena, but not the thing.

We need to teach children to see before they can think.
There is no way to test this in a multiple choice exam.

My students are required to observe, and write about, a perennial plant. Each student watches the same plant throughout the school year. A few thought it was, well, pointless when they started, but since it was easy point, I did not get too much push-back.

And now they have grown attached to what they didn't notice before.

No ideas but in things.

The photo was lifted from The Poetry Foundation.

Fairy sparkles

In winter, I get dressed in the dark.

This morning, I got dressed in clothes that were tumbling in the dryer just minutes before--my t-shirt sparkled and crackled with static electricity.

I wanted to see what that would look like if I put the t-shirt on with my eyes open.

My eyelids must have gotten charged up, because right after I screwed my head through the neckhole, a bright sparkle arced across my left eyelashes, bright enough to startle me.

If I didn't know any better, I'd bless the fairies that danced near my face. (And I don't know any better, so I did.)

***

We call it "static electricity." I thought about voltages and arcs and other nonsense that hardly explains what I saw, then I thought about what I saw.

I didn't see volts. I saw bright blue flashes undulating under the cotton, heard the crackling.

While it is fun to think of ridiculously high voltages (thousands!) involved when electricity arcs across my eyelashes--just the sort of pseudoscience nonsense we toss at kids in class--"knowing" the voltage had no effect on what I observed.

If I ever get my physical science classes back, that will be one of my assignments--grab clothes out of the dryer on a cold, dry day, and get dressed in the dark.

I'll leave out the blessing part. I bet some of them do anyway.

Lightning photo by MONDO,via wikimedia, released to public

Psoriatic Luddite Society

It's winter here.
It's dark, dry, and cold.

In a week when not one but two of my college bound lambs could not divide by ten "in their heads," I rail for the almost extinct slide rule.

I was the the last of the slipstick generation--in 1976, the first scientific calculator appeared in my high school physics class. I could do some functions faster than the electronic machine.

I still have mine-a mahogany Keuffel & Esser 4081-3 Log Log Duplex Decitrig, first picked up by my Dad in the 1950's.

OK, you old fart, that was then, this is now...you don't still use that thing, do you?

I do indeed.
My K&E makes for a great back scritcher! Try doing that with your TI 83.

Think, Arne, think

"The message here is unmistakable: We have no choice but to educate our way to a better economy. And if you care about job growth and boosting incomes, schools are the game changer."

Arne Duncan, Remarks to the National Conference of State Legislatures
December 10, 2009

Nice rhetoric.

Here's the real game-changer:





In our current economy, 10% of the population grabs over 70% 0f the wealth, numbers we haven't seen since before the last Great Depression.

If you prefer pie charts, here's one put together by G. William Domhoff:







If every last one of our children earned an advanced degree within 8 years of graduating from high school, we'd still have a problem.

Oversimplification? Perhaps. Hard to hold an adult discussion anymore.

The diagram put together by the Wobblies--not just your great-grandparents' union.

New Year's Day

And so we're told this is the golden age
And gold is the reason for the wars we wage
Though I want to be with you
Be with you night and day
Nothing changes
On New Year's Day

U2, New Year's Day

Leslie and I went for a long beach walk on New Year's, as we have for years, and as we will, God willing. I liked the first walk so much I went for another as the sun slid over the edge of the bay.

We do this instead of resolutions.

I cannot adequately describe a winter beach, but I will try. The thoughts are scattered, as my thoughts usually are, and I am laying them down for me, to remind me what matters in the next few days, few weeks, few months, as I go back to the classroom.

At low tide, the Delaware Bay recedes from our flat beaches as though swallowed by the first of The Five Chinese Brothers.

The light is a riotous gray--steel gray sky against a changing gray sea. The splashes of white from the waves seem out of place. If you look at the sky, patterns emerge, a blue-gray swirl blending with a patch of green-gray, ever-changing.

The wind whistles through your hoodie, occasionally overwhelming the mesmerizing call of the waves. The waves never stop, they never stop. Sometimes I do not hear them, then remember they never stop, and I hear them again. A crow caws. The gulls were strangely silent.

You smell the salt air tinged with odd sweetness of bay mud. In the summer, the death smell of the bay mud is more obvious, but less noticeable. In January, the tinge of death is dulled by the cold, but on this wintry beach there is little visible life to deflect its message.

I dug into the mudflat, to find a clam. The water stings. Later, on the way home in a cozily warm car, the aroma of the little mud left on my hand overwhelms my thoughts.

We saw a few vultures hovering over the beach a couple hundred yards up--beneath them, a large sea gull dragged its tattered left wing, foraging the ebb tide for the last time. There was enough life left in the gull to scatter the vultures. They will return with the tide.

At low tide, the tidal flat reaches out hundreds of yards--in the distance I saw a lone blue heron standing at the edge of a tide pool. There is enough life to sustain her. I look harder.

Tiny whelks are buried in the mud--the air is near freezing, the water a cozy 40 degrees F. There's more life present than I had realized.

About 30 yards away I see a huge horseshoe crab shell. I worked my way through the shallow pools to the shell, perhaps to use for class.

The shell is half buried in the mud, with characteristic tracks leading to where she lay--the horseshoe crab was very much alive.

I was tempted to move her back into the water--if the temperatures dropped below freezing before the new tide flooded the flats, she would freeze.

A large horseshoe crab is almost always female; one this large certainly was. She was likely near 20 years old, old enough to know what she was doing.

I headed back home.

Back in the classroom soon: WAC assignments, NCLB mandates, HSPA tests, UbD questions, NJCCCS. Acronyms developed by committees formed under the dull hum of fluorescent light.

I wonder what committees under sunlight would create?

But we cannot do that, we would be distracted,
we have important work to do!

If an idea seems silly literally under the light of day, then maybe it's the idea, not the light source.

So what am I going to do about this? If I am so enamored of the flats, of being surrounded by the natural world, yet teach under fluorescent lights, who's the villain?

Time for a field trip, to take my lambs to the real world, the one beyond the matrix we've created.

So here's my resolution: take a busload of kids to the shore, ostensibly to study something seemingly scientific, and let them loose among the mating horseshoe crabs this May.

New Jersey drinks the NCLB Kool-Aid

What's wrong with this picture?

Just to be clear, my quotes from the NJ DOE are not satire--
they are lifted directly from the NJ Core Curriculum Content Standards here.

I am not sure that folks outside education quite grasp what is happening within it.

I graduated high school in 1977. We had standards. Really.

I could handle a slide rule. I knew enough chemistry to make an attempt at creating nitrous oxide ("laughing gas") in class. I wrote history papers using primary sources. I could manipulate differential equations.

I learned to play the trumpet, use a miter box, kiss, gap a spark plug, and defend myself.

Some teachers were wonderful, a few were idiots, and at least one was a drunk.

Overall, I think public schooling did more good than harm.

***

New Jersey has a set of core curriculum standards; I imagine every other state has as well.

Before I go on, I want you to think about a 4 year old child. What should matter to that child? What should that child know?

In New Jersey, that same child is expected to "use basic technology terms in conversations (e.g., digital camera, battery, screen, computer, Internet, mouse, keyboards, and printer."

She is also expected to "use electronic devises [sic] (e.g., computer) to type name and to create stories with pictures and letters/words." Yes, our core curriculum standards committee apparently does not know how to use a spell checker correctly.

Young children do not need time in front of screens. They do not need to drop words like "digital camera" in conversation. ("Digital" is superfluous anyway--it presumes that some people still used film-based 'devises.')

***

Now imagine Elisa at 9. In most countries, she's still a child.

Here, she's required to "create a document with text formatting and graphics using a word processing program, create and present a multimedia presentation that includes graphics," and "create a simple spreadsheet, enter data, and interpret the information."

A little make-up and the right blazer, and she's ready for Kelly Services.

This is obscene.

***

By the end of 8th grade, Elisa will be able to "work in collaboration with peers and experts in the field to develop a product using the design process, data analysis, and trends, and maintain a digital log with annotated sketches to record the development cycle."

Why waste time in high school? She's ready for the boardroom.

***

By 12th grade, Elisa graduates from office clerk to corporate lawyer--she will be able to "demonstrate appropriate use of copyrights as well as fair use and Creative Commons guidelines" and "compare and contrast international government policies on filters for censorship."

If we work hard enough, she can pass the bar exam without bothering with law school.

***

I am a retired pediatrician. I know a little bit about kids. I am also a teacher. I know a little bit about the classroom.

Humans have not evolved much in two generations.

The committee developing the New Jersey Core Curriculum Content Standards might want to dedicate a few minutes of their next meeting to chatting with a live, normal school-aged child.

You can find plenty in the schools, sitting in classrooms. If you have trouble recognizing one (they tend to be smaller, less hairy, and cheerier than adults), a teacher will be glad to point one out to you.

Kids are kids, and no set of "standards" can buck a few billion years of evolution.